Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 3942512
End position: 3942535
Length: 24

DNA sequence
>NC_017933, from 3942512 to 3942535 (24 bp); Cronobacter sakazakii ES15 CAGCAACAGCTACAGCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3942271-3942639	Sequence	ES15_3631 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 3942639 to 3942271)