Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 3822051
End position: 3822074
Length: 24

DNA sequence
>NC_017933, from 3822051 to 3822074 (24 bp); Cronobacter sakazakii ES15 TCGCTTTTGCTTTCGCTTCCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3821777-3822949	Sequence	ES15_3527 obgE GTPase ObgE (Protein is coded in complementary strand; from 3822949 to 3821777)