Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 3429761
End position: 3429784
Length: 24

DNA sequence
>NC_017933, from 3429761 to 3429784 (24 bp); Cronobacter sakazakii ES15 GCTGCTGCTGTTGCGGCTGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3429685-3432216	Sequence	ES15_3179 mrcB bifunctional glycosyl transferase/transpeptidase (Protein is coded in complementary strand; from 3432216 to 3429685)