Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 3424786
End position: 3424809
Length: 24

DNA sequence
>NC_017933, from 3424786 to 3424809 (24 bp); Cronobacter sakazakii ES15 GCGCCAGCGACAGCGCAAGCCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3423501-3425486	Sequence	ES15_3175 - iron-hydroxamate transporter permease subunit (Protein is coded in complementary strand; from 3425486 to 3423501)