Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 3181844
End position: 3181870
Length: 27

DNA sequence
>NC_017933, from 3181844 to 3181870 (27 bp); Cronobacter sakazakii ES15 CCTCTTCATCCTCTTCTTCCTCGTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3180691-3182031	Sequence	ES15_2951 - hypothetical protein (Protein is coded in complementary strand; from 3182031 to 3180691)