Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 3023407
End position: 3023454
Length: 48

DNA sequence
>NC_017933, from 3023407 to 3023454 (48 bp); Cronobacter sakazakii ES15 GTCGGCGTATCCGTCGGCGTATCCGTCGGCGTATCCGTCGGCGTATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3023290-3025725	Sequence	ES15_2809 - hypothetical protein (Protein is coded in complementary strand; from 3025725 to 3023290)