Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 2916890
End position: 2916914
Length: 25

DNA sequence
>NC_017933, from 2916890 to 2916914 (25 bp); Cronobacter sakazakii ES15 GGCGCGGCTCCGCGCGGCGCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2916700-2917356	Sequence	ES15_2717 - putative allophanate hydrolase subunit 1 (Protein is coded in complementary strand; from 2917356 to 2916700)