Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 2886820
End position: 2886864
Length: 45

DNA sequence
>NC_017933, from 2886820 to 2886864 (45 bp); Cronobacter sakazakii ES15 GCGGCTTTCTCAGCGGCAGCTTTTTCCGCGGCCGCTTTTTCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2886340-2887608	Sequence	ES15_2690 tolA cell envelope integrity inner membrane protein TolA (Protein is coded in complementary strand; from 2887608 to 2886340)