Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 2541348
End position: 2541374
Length: 27

DNA sequence
>NC_017933, from 2541348 to 2541374 (27 bp); Cronobacter sakazakii ES15 GACGGCACGGACGGCACGGTCGGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2540865-2541527	Sequence	ES15_2381 - hypothetical protein (Protein is coded in complementary strand; from 2541527 to 2540865)