Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 2528639
End position: 2528674
Length: 36

DNA sequence
>NC_017933, from 2528639 to 2528674 (36 bp); Cronobacter sakazakii ES15 CAAGGAGCGCGCCCAGCAGCGCGCCAAACAGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2528449-2529648	Sequence	ES15_2371 lolC outer membrane-specific lipoprotein transporter subunit LolC (Protein is coded in complementary strand; from 2529648 to 2528449)