Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 2335368
End position: 2335395
Length: 28

DNA sequence
>NC_017933, from 2335368 to 2335395 (28 bp); Cronobacter sakazakii ES15 GCTTTCAGCTTTCCGCTGTCAGCATTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2335353-2336045	Sequence	ES15_2191 - hypothetical protein (Protein is coded in complementary strand; from 2336045 to 2335353)