Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 1703560
End position: 1703583
Length: 24

DNA sequence
>NC_017933, from 1703560 to 1703583 (24 bp); Cronobacter sakazakii ES15 TGATGATGACGATGATGATCATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1703208-1704152	Sequence	ES15_1597 znuA high-affinity zinc transporter periplasmic protein