Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 1595305
End position: 1595349
Length: 45

DNA sequence
>NC_017933, from 1595305 to 1595349 (45 bp); Cronobacter sakazakii ES15 TGCGCGTTCTGACCATTGGCGTTCTGACCGTTGGCGTTCTGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1594648-1596273	Sequence	ES15_1491 fliF flagellar M-ring protein FliF (Protein is coded in complementary strand; from 1596273 to 1594648)