Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 1326185
End position: 1326208
Length: 24

DNA sequence
>NC_017933, from 1326185 to 1326208 (24 bp); Cronobacter sakazakii ES15 GGTGGCGGTGACGGTCGCGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1325250-1327109	Sequence	ES15_1234 - hypothetical protein (Protein is coded in complementary strand; from 1327109 to 1325250)