Sequence retrieval

Genome: Cronobacter sakazakii ES15
Start position: 1136160
End position: 1136204
Length: 45

DNA sequence
>NC_017933, from 1136160 to 1136204 (45 bp); Cronobacter sakazakii ES15 CGCACCAGCAGCGCGCTCGCCAGCAGCGCCAGCACAAGCAGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1135803-1136795	Sequence	ES15_1061 fepG iron-enterobactin transporter permease FepG (Protein is coded in complementary strand; from 1136795 to 1135803)