Sequence retrieval

Genome: Streptococcus thermophilus MN-ZLW-002
Start position: 310652
End position: 310687
Length: 36

DNA sequence
>NC_017927, from 310652 to 310687 (36 bp); Streptococcus thermophilus MN-ZLW-002 AAGTTCCGCCACCATTTCCGCCACCATTTCCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 310606-311433	Sequence	Y1U_C0316 - Mannose-specific phosphotransferase system component IIC low (Protein is coded in complementary strand; from 311433 to 310606)