Sequence retrieval

Genome: Streptococcus thermophilus MN-ZLW-002
Start position: 224633
End position: 224656
Length: 24

DNA sequence
>NC_017927, from 224633 to 224656 (24 bp); Streptococcus thermophilus MN-ZLW-002 GTAGAAGTAGAAGTAGAAGTAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 224621-226963	Sequence	Y1U_C0220 - penicillin-binding protein 1A (Protein is coded in complementary strand; from 226963 to 224621)