Sequence retrieval

Genome: Streptococcus thermophilus MN-ZLW-002
Start position: 1402378
End position: 1402427
Length: 50

DNA sequence
>NC_017927, from 1402378 to 1402427 (50 bp); Streptococcus thermophilus MN-ZLW-002 TTAACTCCTATTAACTCCTATTAACTCCTATTAACTCCTATTAACTCCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1402426-1402989	Sequence	Y1U_C1437 - GTP cyclohydrolase I (Protein is coded in complementary strand; from 1402989 to 1402426)