Sequence retrieval

Genome: Streptococcus thermophilus MN-ZLW-002
Start position: 1402374
End position: 1402423
Length: 50

DNA sequence
>NC_017927, from 1402374 to 1402423 (50 bp); Streptococcus thermophilus MN-ZLW-002 CATTTTAACTCCTATTAACTCCTATTAACTCCTATTAACTCCTATTAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1401577-1402377	Sequence	Y1U_C1436 - dihydropteroate synthase (Protein is coded in complementary strand; from 1402377 to 1401577)