Sequence retrieval

Genome: Streptococcus thermophilus MN-ZLW-002
Start position: 1272081
End position: 1272104
Length: 24

DNA sequence
>NC_017927, from 1272081 to 1272104 (24 bp); Streptococcus thermophilus MN-ZLW-002 GCCTTTTTGCCATTTTGCCTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1271948-1272994	Sequence	Y1U_C1307 - aldose 1-epimerase (Protein is coded in complementary strand; from 1272994 to 1271948)