Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 931049
End position: 931072
Length: 24

DNA sequence
>NC_017790, from 931049 to 931072 (24 bp); Deinococcus gobiensis I-0 CGGGGTGGGGGTCGGGGCCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 930960-932363	Sequence	DGo_CA0833 ftsA Cell division protein FtsA (Protein is coded in complementary strand; from 932363 to 930960)