Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 930507
End position: 930530
Length: 24

DNA sequence
>NC_017790, from 930507 to 930530 (24 bp); Deinococcus gobiensis I-0 CGCTGCCGGTGCCGGTGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 929744-930823	Sequence	DGo_CA0832 ftsZ Cell division protein ftsZ (Protein is coded in complementary strand; from 930823 to 929744)