Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 860230
End position: 860254
Length: 25

DNA sequence
>NC_017790, from 860230 to 860254 (25 bp); Deinococcus gobiensis I-0 CGGCGCTGCGCGGCGCGGCGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 859993-861006	Sequence	DGo_CA0775 oppD Oligopeptide/dipeptide ABC transporter, ATPase subunit