Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 743843
End position: 743866
Length: 24

DNA sequence
>NC_017790, from 743843 to 743866 (24 bp); Deinococcus gobiensis I-0 GGGGGTCGGGGGATCGGGGGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 743292-743879	Sequence	DGo_CA0677 - MarR family transcriptional regulator (Protein is coded in complementary strand; from 743879 to 743292)