Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 607676
End position: 607702
Length: 27

DNA sequence
>NC_017790, from 607676 to 607702 (27 bp); Deinococcus gobiensis I-0 CCCAGAGCGCCCTGAGCGCCCAGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 607481-608719	Sequence	DGo_CA0576 - proprotein convertase subtilisin/kexin typ e 9 preproprotein