Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 539761
End position: 539784
Length: 24

DNA sequence
>NC_017790, from 539761 to 539784 (24 bp); Deinococcus gobiensis I-0 GCTGGCGGTGGCGCTGGCGCTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 538580-541687	Sequence	DGo_CA0519 - Alpha amylase, catalytic region (Protein is coded in complementary strand; from 541687 to 538580)