Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 530355
End position: 530378
Length: 24

DNA sequence
>NC_017790, from 530355 to 530378 (24 bp); Deinococcus gobiensis I-0 CTGGTTCTGATTCTGGTCCTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 529951-530388	Sequence	DGo_CA0509 - Putative transmembrane protein (Protein is coded in complementary strand; from 530388 to 529951)