Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 511613
End position: 511636
Length: 24

DNA sequence
>NC_017790, from 511613 to 511636 (24 bp); Deinococcus gobiensis I-0 CGGGGTGGGGGTCGGGGTGGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 511599-511715	Sequence	DGo_CA0488 - hypothetical protein (Protein is coded in complementary strand; from 511715 to 511599)