Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 448672
End position: 448695
Length: 24

DNA sequence
>NC_017790, from 448672 to 448695 (24 bp); Deinococcus gobiensis I-0 GGTCGGGGTGGGGGTCGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 447818-450184	Sequence	DGo_CA0427 - Peptidase S8, subtilisin family (Protein is coded in complementary strand; from 450184 to 447818)