Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 443238
End position: 443261
Length: 24

DNA sequence
>NC_017790, from 443238 to 443261 (24 bp); Deinococcus gobiensis I-0 GCAGCAGGAGCAGCCGCAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 441968-443467	Sequence	DGo_CA0421 thiP ABC Fe3+ transporter, permease protein, CysTW family (Protein is coded in complementary strand; from 443467 to 441968)