Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 394472
End position: 394495
Length: 24

DNA sequence
>NC_017790, from 394472 to 394495 (24 bp); Deinococcus gobiensis I-0 CGCAGCGGCAGCCCCAGCAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 394262-394705	Sequence	DGo_CA0376 yqgF Holliday junction resolvase YqgF (Protein is coded in complementary strand; from 394705 to 394262)