Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 3120438
End position: 3120473
Length: 36

DNA sequence
>NC_017790, from 3120438 to 3120473 (36 bp); Deinococcus gobiensis I-0 CGACCGCGCCCACGCCTGCGCCCACGCCCGAGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3120197-3120844	Sequence	DGo_CA2942 - hypothetical protein (Protein is coded in complementary strand; from 3120844 to 3120197)