Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 3087965
End position: 3088024
Length: 60

DNA sequence
>NC_017790, from 3087965 to 3088024 (60 bp); Deinococcus gobiensis I-0 CGGCGGCGCTCGTCGCGGCGGCCCTCATCCCGGCGGCCCTCGAAGCGGCGGCGCTCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3087272-3088972	Sequence	DGo_CA2913 recQ2 Nucleic acid-binding protein, putative, HRDC family (Protein is coded in complementary strand; from 3088972 to 3087272)