Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2989072
End position: 2989095
Length: 24

DNA sequence
>NC_017790, from 2989072 to 2989095 (24 bp); Deinococcus gobiensis I-0 CCGCCATCGCCACCGCGACCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2987718-2989916	Sequence	DGo_CA2812 mmpL hypothetical protein (Protein is coded in complementary strand; from 2989916 to 2987718)