Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2980451
End position: 2980475
Length: 25

DNA sequence
>NC_017790, from 2980451 to 2980475 (25 bp); Deinococcus gobiensis I-0 GCGCCGCGCCGCGCCGGGCCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2980381-2981178	Sequence	DGo_CA2804 folP Dihydropteroate synthase (Protein is coded in complementary strand; from 2981178 to 2980381)