Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2903386
End position: 2903430
Length: 45

DNA sequence
>NC_017790, from 2903386 to 2903430 (45 bp); Deinococcus gobiensis I-0 CGTGCCGCTGCCCGACATCCCACTGCCCGACATCCCGCTGCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2902886-2903638	Sequence	DGo_CA2746 - Cytochrome c, class I (Protein is coded in complementary strand; from 2903638 to 2902886)