Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2817099
End position: 2817125
Length: 27

DNA sequence
>NC_017790, from 2817099 to 2817125 (27 bp); Deinococcus gobiensis I-0 CACGCGGGTCTCGCGGGTCTCGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2816908-2817219	Sequence	DGo_CA2664 - Septum formation initiator, FtsB-like protein (Protein is coded in complementary strand; from 2817219 to 2816908)