Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2663074
End position: 2663097
Length: 24

DNA sequence
>NC_017790, from 2663074 to 2663097 (24 bp); Deinococcus gobiensis I-0 CGTCGCCGTCGGGGTCGCCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2662326-2664197	Sequence	DGo_CA2506 - amylo-alpha-1,6-glucosidase (Protein is coded in complementary strand; from 2664197 to 2662326)