Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2628177
End position: 2628221
Length: 45

DNA sequence
>NC_017790, from 2628177 to 2628221 (45 bp); Deinococcus gobiensis I-0 CTGGCGCTGCGCCTGCTCGCGCTGGGTCTGCTGGCGCTGGGTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2626345-2628495	Sequence	DGo_CA2468 - hypothetical protein (Protein is coded in complementary strand; from 2628495 to 2626345)