Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2621383
End position: 2621406
Length: 24

DNA sequence
>NC_017790, from 2621383 to 2621406 (24 bp); Deinococcus gobiensis I-0 TGCCGCCGCCGCTGCCGCTGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2620449-2623829	Sequence	DGo_CA2465 - Cation/multidrug efflux pump (Protein is coded in complementary strand; from 2623829 to 2620449)