Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2512199
End position: 2512225
Length: 27

DNA sequence
>NC_017790, from 2512199 to 2512225 (27 bp); Deinococcus gobiensis I-0 CGCCCCGAGCGCCGCGAGCGCCCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2511900-2512529	Sequence	DGo_CA2364 gntR GntR family transcriptional regulator (Protein is coded in complementary strand; from 2512529 to 2511900)