Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2485047
End position: 2485070
Length: 24

DNA sequence
>NC_017790, from 2485047 to 2485070 (24 bp); Deinococcus gobiensis I-0 GCAGGGCCAGGGGCACGGTCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2484140-2485129	Sequence	DGo_CA2336 - hypothetical protein (Protein is coded in complementary strand; from 2485129 to 2484140)