Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2429173
End position: 2429205
Length: 33

DNA sequence
>NC_017790, from 2429173 to 2429205 (33 bp); Deinococcus gobiensis I-0 CGCGCCGCCCGCGCGCAGCCGGCTCGCCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2428598-2429578	Sequence	DGo_CA2289 - tRNA methyltransferase (Protein is coded in complementary strand; from 2429578 to 2428598)