Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2422730
End position: 2422759
Length: 30

DNA sequence
>NC_017790, from 2422730 to 2422759 (30 bp); Deinococcus gobiensis I-0 CCCGTCGCCGCCCGGCGCCACTCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2422007-2422888	Sequence	DGo_CA2279 - hypothetical protein (Protein is coded in complementary strand; from 2422888 to 2422007)