Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2396633
End position: 2396656
Length: 24

DNA sequence
>NC_017790, from 2396633 to 2396656 (24 bp); Deinococcus gobiensis I-0 CATCAGCAGCAGCACCAGGATCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2395386-2396663	Sequence	DGo_CA2251 - Pilus-associated protein, PilW-related protein (Protein is coded in complementary strand; from 2396663 to 2395386)