Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2354607
End position: 2354630
Length: 24

DNA sequence
>NC_017790, from 2354607 to 2354630 (24 bp); Deinococcus gobiensis I-0 CGGCGGCAGCGGCAGCGGAGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2354248-2355207	Sequence	DGo_CA2213 - Sectered polysaccharide deacetylase (Protein is coded in complementary strand; from 2355207 to 2354248)