Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2327458
End position: 2327493
Length: 36

DNA sequence
>NC_017790, from 2327458 to 2327493 (36 bp); Deinococcus gobiensis I-0 CGTCGCCCAGCATGTCGCGCAGCACGTCGGCCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2326758-2327522	Sequence	DGo_CA2189 - N-formylglutamate amidohydrolase (Protein is coded in complementary strand; from 2327522 to 2326758)