Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2191892
End position: 2191915
Length: 24

DNA sequence
>NC_017790, from 2191892 to 2191915 (24 bp); Deinococcus gobiensis I-0 AGGCTCAGGCGCAGGGTCAGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2191640-2192056	Sequence	DGo_CA2057 - DinB/YfiT family metal-binding protein (Protein is coded in complementary strand; from 2192056 to 2191640)