Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 2018332
End position: 2018376
Length: 45

DNA sequence
>NC_017790, from 2018332 to 2018376 (45 bp); Deinococcus gobiensis I-0 CGTTGGGGGCCGCGTCGGGGGTGGCCGCGTCGGGGGTGGCCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2017431-2019815	Sequence	DGo_CA1871 - hypothetical protein (Protein is coded in complementary strand; from 2019815 to 2017431)