Sequence retrieval

Genome: Deinococcus gobiensis I-0
Start position: 1953122
End position: 1953148
Length: 27

DNA sequence
>NC_017790, from 1953122 to 1953148 (27 bp); Deinococcus gobiensis I-0 CGGCCTGCTCGGCCAGCTCGGCCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1951960-1953867	Sequence	DGo_CA1810 - PRC-barrel domain-containing protein (Protein is coded in complementary strand; from 1953867 to 1951960)